Skip to main content

Table 3 Exonic de novo variants in the affected twin in family 1 (I-2-1)

From: Post-zygotic genomic changes in glutamate and dopamine pathway genes may explain discordance of monozygotic twins for schizophrenia

Chr Position Ref Sample Type Cytoband Gene Translation impact dbSNP ID 1000 genomes CG public genomes
1 117142868 CA TG Sub 1p13.1 IGSF3 In-frame    
4 85996   C Ins 4p16.3 ZNF595 Frame shift    
4 86004 A G SNV 4p16.3 ZNF595 Missense 112290390   
4 86022 CAG GAC Sub 4p16.3 ZNF595 In-frame 386670355   
4 86043 T C SNV 4p16.3 ZNF595 Synonymous 377364445   
7 100549935 T G SNV 7q22.1 MUC3A Missense 73714229   
7 100549942 T C SNV 7q22.1 MUC3A Missense 73714230   
7 100552452 T C SNV 7q22.1 MUC3A Synonymous 112050489   
11 48367133 C A SNV 11p11.2 OR4C45 Missense 79453749   
12 40875389 CCATCAGCTGGAGTGACAGTGACATCCGGA Del 12q12 MUC19 In-frame    
12 40880542 C T SNV 12q12 MUC19 Missense 370502411   14.81
12 40880545 C G SNV 12q12 MUC19 Missense 199768257   16.66
12 122359397   GAGGAGGAGGAGAAA Ins 12q24.31 WDR66 In-frame 142042908   67.59
13 25671607 GA AG Sub 13q12.13 PABPC3 In-frame 386769143   
13 46170723 GATACTCTTCCTCCTCCA Del 13q14.13 ERICH6B In-frame    
17 74288565 TGA   Del 17q25.1 QRICH2 In-frame 35035566 46.96 20.37
22 29885594 A T SNV 22q12.2 NEFH Synonymous 79235463   
22 29885599 AGGAAG   Del 22q12.2 NEFH In-frame 149571560   
  1. Gene variants in bold are not known to be polymorphic and considered novel and potential pathogenic impact is marked in bolditalic