Skip to main content

Table 4 Exonic de novo variants in the affected twin in family 2 (II-2-1)

From: Post-zygotic genomic changes in glutamate and dopamine pathway genes may explain discordance of monozygotic twins for schizophrenia

Chr Position Ref Sample Type Cytoband Gene Translation impact dbSNP ID 1000 genomes CG public genomes
1 1650787 T C SNV 1p36.33 CDK11B; CDK11A Missense 1137003   28.7
1 1650797 A G SNV 1p36.33 CDK11B; CDK11A Missense 1059830   31.48
1 1650801 T C SNV 1p36.33 CDK11B; CDK11A Synonymous 1137004   31.48
1 13183225 T C SNV 1p36.21 HNRNPCL1/HNRNPCL2 Synonymous 28634306   
1 13183228 C T SNV 1p36.21 HNRNPCL1/HNRNPCL2 Synonymous 144054379   
1 13183237 CT TC Sub 1p36.21 HNRNPCL1/HNRNPCL2 In-frame    
1 13183243 T C SNV 1p36.21 HNRNPCL1/HNRNPCL2 Synonymous 138897759   
1 13183248 TC AA Sub 1p36.21 HNRNPCL1/HNRNPCL2 In-frame    
1 17266536 G C SNV 1p36.13 CROCC Missense 9435714   10.18
1 62675619 C T SNV 1p31.3 L1TD1 Synonymous 4625314 29.85 33.33
1 109007867 G A SNV 1p13.3 NBPF4/NBPF6 Missense    26.85
1 109007877 T G SNV 1p13.3 NBPF4/NBPF6 Synonymous    26.85
1 109737063 C T SNV 1p13.3 KIAA1324 Synonymous 386565601 71.37 68.51
1 109737090 G A SNV 1p13.3 KIAA1324 Synonymous 386565600 71.53 67.59
1 111957583 A G SNV 1p13.2 OVGP1 Missense 1126656   3.7
1 111957592 A G SNV 1p13.2 OVGP1 Missense 56294468 22.32 3.7
1 120539742 G A SNV 1p12 NOTCH2 Missense 2258139   
1 120548025 G A SNV 1p12 NOTCH2 Synonymous 140551270   
1 120548055 T C SNV 1p12 NOTCH2 Synonymous 199592384   
1 144873963 T   Del 1q21.1 PDE4DIP Frame shift   28.91 32.4
1 144922523 C T SNV 1q21.1 PDE4DIP Missense 2455994   28.7
1 145103928 G A SNV 1q21.1 SEC22B Synonymous 2596251 34.01 35.18
1 201178819 G A SNV 1q32.1 IGFN1 Missense 72468019   11.11
1 206566904 T C SNV 1q32.1 SRGAP2B; SRGAP2D; SRGAP2; SRGAP2C Synonymous 2919105 49.44  
1 248813827 T C SNV 1q44 OR2T27 Missense 1782241   
2 132238043 A C SNV 2q21.1 TUBA3C/TUBA3D Synonymous 74625243   14.81
3 75786499 CA TG Sub 3p12.3 ZNF717 In-frame    0.92
3 75786515 GG AT Sub 3p12.3 ZNF717 In-frame   0.92  
3 75787265 C G SNV 3p12.3 ZNF717 Synonymous 144538707   
3 75787269 G T SNV 3p12.3 ZNF717 Missense    
3 75788023 C T SNV 3p12.3 ZNF717 Missense 76889571   50
3 100170634 T C SNV 3q12.2 LNP1 Synonymous 9848109   24.07
3 195510827 C T SNV 3q29 MUC4 Missense 413807 3.53 24.07
3 195511780 G A SNV 3q29 MUC4 Missense 391928   
5 140725160   A Insertion 5q31.3 PCDHGA3; PCDHGA2; PCDHGA1 Frame shift 372306793   
6 26406255 G A SNV 6p22.2 BTN3A1 Synonymous 3857550   41.66
6 33037579 AT TG Sub 6p21.32 HLA-DPA1 In-frame 386699858   37.96
6 33052986 T C SNV 6p21.32 HLA-DPB1 Synonymous   46.37 37.03
7 100550039   CTC Ins 7q22.1 MUC3A In-frame    
7 142460313 T C SNV 7q34 PRSS1 Synonymous 6666 39.66 24.07
7 142460335 A G SNV 7q34 PRSS1 Missense 201550522 0.16  
8 10467652 GC CT Sub 8p23.1 RP1L1 In-frame 386722180   
8 103573011 TGCAACCCCTGCAGCCCCTGCAACCCG Del 8q22.3 ODF1 In-frame   31.29 23.14
11 1016776 C T SNV 11p15.5 MUC6 Missense 33988517   38.88
11 1017110 CGGT TGCC Sub 11p15.5 MUC6 In-frame    32.4
11 1018069 G A SNV 11p15.5 MUC6 Missense 10736904   
11 1018090 G   Del 11p15.5 MUC6 Frame shift    
11 1018095 G TA Sub 11p15.5 MUC6 Frame shift    
11 1092684 C T SNV 11p15.5 MUC2 Synonymous 201269049   
11 5270686 G A SNV 11p15.4 HBG1 Missense 1061234   75.92
11 18290866 T C SNV 11p15.1 SAA1 Synonymous 1136745   
11 48346916 G C SNV 11p11.2 OR4C3 Missense 77069283   
11 48346924 T C SNV 11p11.2 OR4C3 Synonymous 72911454   
11 48346932 G A SNV 11p11.2 OR4C3 Missense 80285195 0.28  
11 48347306 G T SNV 11p11.2 OR4C3 Missense 73465911   33.33
11 48367052   AG Ins 11p11.2 OR4C45 Frame shift    
11 48367073 A C SNV 11p11.2 OR4C45 Missense 7941588 79.55 75
11 56143357 G A SNV 11q12.1 OR8U1; OR8U8 Synonymous 76949582   36.11
11 56143963 AATCTATAGC GATTTACAGT Sub 11q12.1 OR8U1; OR8U8 Synonymous    
11 56468020 T C SNV 11q12.1 OR9G1; OR9G9 Missense 532637 41.21 56.48
11 57982726 G T SNV 11q12.1 OR1S1 Synonymous 1993089 52.32 52.77
11 57982763 A G SNV 11q12.1 OR1S1 Missense 61763008   50.92
11 89703619 G A SNV 11q14.3 TRIM64/TRIM64B Missense 79824618   77.77
11 89819403 G T SNV 11q14.3 UBTFL1 Missense    
12 11214857 T C SNV 12p13.2 TAS2R46; PRH1 Missense 201891491   
12 11214870 A T SNV 12p13.2 TAS2R46; PRH1 Synonymous 200226376   
12 11244721 GAA CAC Sub 12p13.2 TAS2R43; PRH1 In-frame    19.44
12 11244730 AA GG Sub 12p13.2 TAS2R43; PRH1 In-frame    18.51
12 49522578 T C SNV 12q13.12 TUBA1B Synonymous 1057725 54.49  
12 49522605 C T SNV 12q13.12 TUBA1B Synonymous 1057548 45.33  
12 52843610 C A SNV 12q13.13 KRT6B Missense    
13 46170724 ATACTCTTCCTCCTCCAG Del 13q14.13 ERICH6B In-frame    
13 53216666 G A SNV 13q14.3 HNRNPA1L2 Synonymous 113869751 1.08 1.85
13 103399222 G T SNV 13q33.1 CCDC168 Stop gain    25
18 9887394 C T SNV 18p11.22 TXNDC2 Synonymous 2240910 51.84  
19 4511197 G A SNV 19p13.3 PLIN4 Synonymous 199625614   
19 4511200 C T SNV 19p13.3 PLIN4 Synonymous 200718202 0.14  
19 55286854 A G SNV 19q13.42 KIR2DL1/KIR2DL3 Missense 666590 0.08  
19 55286864 A C SNV 19q13.42 KIR2DL1/KIR2DL3 Synonymous 77397437 16.63  
21 10942923 G A SNV 21p11.1 TPTE Missense 76723236   7.4
22 38120180 CTC   Del 22q13.1 TRIOBP In-frame    
22 39387558 C T SNV 22q13.1 APOBEC3A_B; APOBEC3B Synonymous 1065184   
  1. Gene variants in bold are not known to be polymorphic and considered de novo and potential pathogenic impact is marked in bolditalic