Skip to main content

Table 1 KIAA1549 and BRAF fusion genes primer sequences

From: Incidence of kiaa1549-braf fusion gene in Egyptian pediatric low grade glioma

Primer name Sequence TM
KIAA1549_15_F(A) 5′ - CGTCCTGGACAAGACCAAGT - 3′ 60
KIAA1549_16_F(A) 5′ - CTCGTCTTTCTCCTGCTCGT - 3′ 60
BRAF_9_R(A) 5′ - ACTCCTGACTGCATGGAAGC - 3′ 60
BRAF_11_R(A) 5′ - GTCCACAGCTGCTTTTCCAC - 3′ 60
KIAA1549_15_F(B) 5′ - CGTCCTGGACAAGACCAAGT - 3′ 60
KIAA1549_16_F(B) 5′ - CTCGTCTTTCTCCTGCTCGT - 3′ 60
BRAF_9_R(B) 5′ - ACTCCTGACTGCATGGAAGC - 3′ 60
BRAF_11_R(B) 5′ - GTCCACAGCTGCTTTTCCAC - 3′ 60