Skip to main content

Table 1 Characteristics of the specific primers used to validate the gene expression results

From: Biomarkers of fatigue related to adjuvant chemotherapy for breast cancer: evaluation of plasma and lymphocyte expression

Gene Sequence (5’ - 3’) Amplicon (bp) No. access
IL2 F-CCCAAGAAGGCCACAGAACT 125 NM_000586.3
R-TTGCTGATTAAGTCCCTGGGT
IL10 F-GCTGAGAACCAAGACCCAGA 141 NM_000572.2
R-ATTCTTCACCTGCTCCACGG
SOD1 F- GGTGGGCCAAAGGATGAAGA 129 NM_000454.4
R- GCCAATGATGCAATGGTCTCC
BLNK F- AACAGGAAGCTGGCGTTCTC 124 NM_013314.3
R- TGGCCAGAGCTTTTCCGAAT
PTGS2 F- TGAGTGTGGGATTTGACCAGT 128 NM_000963.2
R- GTGCACTGTGTTTGGAGTGG
KLRC1 F- ACCATCCTCATGGATTGGTGT 163 NM_002259.4
R- TGAAGATCCACACTGGGCTG
TGB1 F-CTGACTGCTCTGGCTTCCTC 176 NM_002704.3
R- TGGGTTCCTTTCCCGATCAC
IL6 F-CCAGAGCTGTGCAGATGAGT 174 NM_000600.3
R- AGCTGCGCAGAATGAGATGA
IFNG F- TGGAAAGAGGAGAGTGACAGA 122 NM_000619.2
R- TCTTCCTTGATGGTCTCCACAC
TNF F- AGAGGGAAGAGTTCCCCAGG 123 NM_000594.3
R- CCTCAGCTTGAGGGTTTGCT
SNCA F- ATGTTGGAGGAGCAGTGGTG 134 NM_000345.3
R- CTGTGGGGCTCCTTCTTCAT
BTP F- CAGCACCTACTCCGTGTCAG 142 NM_000954.5
R-CTTTAACTCAGCCCTGGGGG